Detail of EST/Unigene BQ165628 |
Acc. | BQ165628 |
Internal Acc. | EST611497 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 1-acyl-sn-glycerol-3-phosphate acyltransferase 1, chloroplastic OS=Brassica napus E-value=0; 1-acyl-sn-glycerol-3-phosphate acyltransferase 1, chloroplastic OS=Arabidopsis thaliana E-value=0; Probable 1-acyl-sn-glycerol-3-phosphate acyltransferase OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=9e-16; 1-acyl-sn-glycerol-3-phosphate acyltransferase OS=Borrelia burgdorferi (strain ATCC 35210 / B31 / CIP 102532 / DSM 4680) E-value=2e-14; 1-acyl-sn-glycerol-3-phosphate acyltransferase OS=Cocos nucifera E-value=1e-13; |
Length | 832 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_KVKC; |
Sequence | CAGCTCGAGACGGGGACGGGAGTATCTGAACCCAAATTGGAAGCAAAACTTAGGGGAATT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00565 Ether lipid metabolism > K00655 1-acyl-sn-glycerol-3-phosphate acyltransferase; Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00655 1-acyl-sn-glycerol-3-phosphate acyltransferase; Metabolism > Lipid Metabolism > ko00564 Glycerophospholipid metabolism > K00655 1-acyl-sn-glycerol-3-phosphate acyltransferase |
EC | 2.3.1.51 |
Transcription Factor Family | |
Transporter Classification Family | 2.A.1 Major facilitator superfamily MFS |
Probeset |
|
Corresponding NCBI Gene | 829181 |
Trichome-related Gene from Literature | N/A |