| Detail of EST/Unigene BQ165631 |
| Acc. | BQ165631 |
| Internal Acc. | EST611500 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin-3, chloroplastic OS=Zea mays E-value=7e-36; Ferredoxin-3, chloroplastic OS=Arabidopsis thaliana E-value=2e-34; Ferredoxin, root R-B1 OS=Raphanus sativus E-value=5e-32; Ferredoxin-1, chloroplastic OS=Pisum sativum E-value=1e-30; Ferredoxin-6, chloroplastic OS=Zea mays E-value=3e-30; |
| Length | 755 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_KVKC; |
| Sequence | TCTTTCTCATTCTTCACTTCATTCTTGTTCAACTAATAAAAATGTCAGCGGTGAATATGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817297 |
| Trichome-related Gene from Literature | N/A |