Detail of EST/Unigene BQ165690 |
Acc. | BQ165690 |
Internal Acc. | EST611559 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein 2, chloroplastic OS=Spinacia oleracea E-value=1e-63; 33 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=7e-30; 29 kDa ribonucleoprotein B, chloroplastic OS=Nicotiana sylvestris E-value=8e-28; 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana plumbaginifolia E-value=1e-27; 29 kDa ribonucleoprotein A, chloroplastic OS=Nicotiana sylvestris E-value=1e-27; |
Length | 717 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_KVKC; |
Sequence | TTTCCTTTCTCTAACTCACAACAACACTCACACAAACTTTACCTTAAAACCCAAAACAAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824379 |
Trichome-related Gene from Literature | N/A |