Detail of EST/Unigene BQ165773 |
Acc. | BQ165773 |
Internal Acc. | EST611642 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Superoxide dismutase [Mn], mitochondrial OS=Prunus persica E-value=7e-54; Superoxide dismutase [Mn], mitochondrial OS=Nicotiana plumbaginifolia E-value=3e-52; Superoxide dismutase [Mn], mitochondrial OS=Hevea brasiliensis E-value=2e-50; Superoxide dismutase [Mn], mitochondrial OS=Capsicum annuum E-value=2e-50; Superoxide dismutase [Mn] 3.1, mitochondrial OS=Zea mays E-value=1e-49; |
Length | 652 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_KVKC; |
Sequence | CGCACAAGATTCTCATTCAAACAAAGTAGTAAACCCTAGAAGCAAAAAATAAAATCTTGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.15.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820263 |
Trichome-related Gene from Literature | N/A |