| Detail of EST/Unigene BQ165817 |
| Acc. | BQ165817 |
| Internal Acc. | EST611686 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin M-type, chloroplastic OS=Pisum sativum E-value=5e-53; Thioredoxin M-type, chloroplastic OS=Spinacia oleracea E-value=1e-48; Thioredoxin M-type, chloroplastic OS=Zea mays E-value=2e-46; Thioredoxin M5, chloroplastic OS=Oryza sativa subsp. japonica E-value=1e-45; Thioredoxin M-type, chloroplastic OS=Triticum aestivum E-value=2e-44; |
| Length | 690 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_KVKC; |
| Sequence | CAAGAAGGAGGGCTGTTTATCCAATGTAAAAAACTTTACAAAATGATTTGAAATAAAGAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820775 |
| Trichome-related Gene from Literature | N/A |