Detail of EST/Unigene BQ165847 |
Acc. | BQ165847 |
Internal Acc. | EST611716 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Sphingosine kinase 2 OS=Homo sapiens E-value=1e-22; Sphingosine kinase 1 OS=Homo sapiens E-value=2e-22; Sphingosine kinase 2 OS=Mus musculus E-value=4e-21; Sphingosine kinase B OS=Dictyostelium discoideum E-value=3e-20; Sphingosine kinase 1 OS=Rattus norvegicus E-value=3e-20; |
Length | 774 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_KVKC; |
Sequence | GTAATTATCTCCGAGACGTGAAAACCGGATTTCATTTACTGAACCGGGTTTCCGGCTGAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00600 Sphingolipid metabolism > K04718 sphingosine kinase; Environmental Information Processing > Signal Transduction > ko04020 Calcium signaling pathway > K04718 sphingosine kinase; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04718 sphingosine kinase |
EC | 2.7.1.91 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828239 |
Trichome-related Gene from Literature | N/A |