| Detail of EST/Unigene CA916863 |
| Acc. | CA916863 |
| Internal Acc. | EST641010 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome b6 OS=Triticum aestivum E-value=3e-11; Cytochrome b6 OS=Welwitschia mirabilis E-value=3e-11; Cytochrome b6 OS=Vitis vinifera E-value=3e-11; Cytochrome b6 OS=Nicotiana tabacum E-value=3e-11; Cytochrome b6 OS=Spinacia oleracea E-value=3e-11; |
| Length | 100 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GPOD; |
| Sequence | ATTCAGGCGATTGCCGATGATATAACTACTAAATATGTTCCTCCTCATGTCAATATATTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | 3.E.2 Photosynthetic reaction center PRC |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |