Detail of EST/Unigene CA916919 |
Acc. | CA916919 |
Internal Acc. | EST641066 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | ATP synthase delta chain, chloroplastic OS=Spinacia oleracea E-value=2e-11; ATP synthase delta chain, chloroplastic OS=Nicotiana tabacum E-value=7e-10; ATP synthase delta chain, chloroplastic OS=Pisum sativum E-value=6e-09; ATP synthase delta chain, chloroplastic OS=Chlamydomonas reinhardtii E-value=1e-07; ATP synthase delta chain, chloroplastic OS=Sorghum bicolor E-value=1e-07; |
Length | 653 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GPOD; |
Sequence | CTACTGCAAACCCTTCTCGTCCTCCACAACCAAAATCTCATTTCTCTTCCAACTTAGTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827987 |
Trichome-related Gene from Literature | N/A |