Detail of EST/Unigene CA916936 |
Acc. | CA916936 |
Internal Acc. | EST641083 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Translation initiation factor IF-1, chloroplastic OS=Glycine max E-value=2e-37; Translation initiation factor IF-1, chloroplastic OS=Cercidiphyllum japonicum E-value=7e-31; Translation initiation factor IF-1, chloroplastic OS=Nandina domestica E-value=1e-30; Translation initiation factor IF-1, chloroplastic OS=Buxus microphylla E-value=1e-30; Translation initiation factor IF-1, chloroplastic OS=Montinia caryophyllacea E-value=3e-30; |
Length | 683 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GPOD; |
Sequence | AAACTAACTTCAACCATAAACCTTCAATTCCTCTAAAAGCCATCATCATCAAAGAAACAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826719 |
Trichome-related Gene from Literature | N/A |