Detail of EST/Unigene CA917100 |
Acc. | CA917100 |
Internal Acc. | EST641247 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Alternative oxidase 2, mitochondrial OS=Glycine max E-value=3e-82; Alternative oxidase, mitochondrial OS=Mangifera indica 1 E-value=2e-68; Alternative oxidase 2, mitochondrial OS=Arabidopsis thaliana E-value=3e-65; Alternative oxidase 3, mitochondrial OS=Glycine max E-value=3e-64; Alternative oxidase 1a, mitochondrial OS=Arabidopsis thaliana E-value=1e-58; |
Length | 736 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GPOD; |
Sequence | TCAAAACGCGATTCCTTCGCTCTCGAAAGATGAAGCATTCAGCATTGTGTTACGTGGCTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836542 |
Trichome-related Gene from Literature | 836542 |