Detail of EST/Unigene CA917509 |
Acc. | CA917509 |
Internal Acc. | EST641656 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Adenylyl-sulfate kinase, chloroplastic OS=Catharanthus roseus E-value=1e-44; Adenylyl-sulfate kinase 1, chloroplastic OS=Arabidopsis thaliana E-value=4e-44; Adenylyl-sulfate kinase 2, chloroplastic OS=Arabidopsis thaliana E-value=6e-43; Adenylyl-sulfate kinase OS=Marinobacter aquaeolei (strain ATCC 700491 / DSM 11845 / VT8) E-value=1e-25; Probable adenylyl-sulfate kinase OS=Bacillus subtilis (strain 168) E-value=3e-25; |
Length | 413 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GPOD; |
Sequence | TACGAGAAAGGACCCTTTAAAACCCCATTATAGCAAACCAAAAAGAAAGGCCCCTCTCAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K00860 adenylylsulfate kinase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K00860 adenylylsulfate kinase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K00860 adenylylsulfate kinase; Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K00958 sulfate adenylyltransferase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K00958 sulfate adenylyltransferase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K00958 sulfate adenylyltransferase |
EC | 2.7.1.25 2.7.7.4 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 815963 |
Trichome-related Gene from Literature | N/A |