Detail of EST/Unigene CA917742 |
Acc. | CA917742 |
Internal Acc. | EST641889 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 11 OS=Arabidopsis thaliana E-value=4e-13; Glucan endo-1,3-beta-glucosidase OS=Triticum aestivum E-value=8e-11; Lichenase-2 (Fragment) OS=Hordeum vulgare E-value=1e-10; Probable glucan endo-1,3-beta-glucosidase A6 OS=Arabidopsis thaliana E-value=2e-08; Glucan endo-1,3-beta-glucosidase 14 OS=Arabidopsis thaliana E-value=3e-08; |
Length | 243 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GPOD; |
Sequence | TCATTGGGGAGATGGTAATATGATTCGTGGTCTTGTTCCTGCTATGAGAACTCTTCATTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824709 |
Trichome-related Gene from Literature | N/A |