| Detail of EST/Unigene CA917792 |
| Acc. | CA917792 |
| Internal Acc. | EST641939 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Serine hydroxymethyltransferase 2 OS=Dictyostelium discoideum E-value=2e-93; Serine hydroxymethyltransferase 1 OS=Dictyostelium discoideum E-value=2e-91; Serine hydroxymethyltransferase, mitochondrial OS=Pisum sativum E-value=1e-86; Serine hydroxymethyltransferase, cytosolic OS=Oryctolagus cuniculus E-value=1e-86; Serine hydroxymethyltransferase 1, mitochondrial OS=Flaveria pringlei E-value=1e-86; |
| Length | 795 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GPOD; |
| Sequence | GATTAGTAACCGTGGACCCAGAAATCCACGACTTAATCGAAAAAGAAAAGCGCCGTCAAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00680 Methane metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K00600 glycine hydroxymethyltransferase |
| EC | 2.1.2.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827027 |
| Trichome-related Gene from Literature | N/A |