| Detail of EST/Unigene CA917848 |
| Acc. | CA917848 |
| Internal Acc. | EST641995 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Polyphenol oxidase A1, chloroplastic OS=Vicia faba E-value=6e-25; Polyphenol oxidase, chloroplastic OS=Malus domestica E-value=7e-12; Polyphenol oxidase, chloroplastic OS=Vitis vinifera E-value=2e-08; Catechol oxidase B, chloroplastic (Fragment) OS=Solanum tuberosum E-value=8e-08; Polyphenol oxidase F, chloroplastic OS=Solanum lycopersicum E-value=2e-07; |
| Length | 269 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_GPOD; |
| Sequence | TTCTAAACATAGAATATTACCAAGACGCCAAGTGATCACATTGAGTGGTAATAATGGTAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | N/A |
| Trichome-related Gene from Literature | N/A |