Detail of EST/Unigene CA917848 |
Acc. | CA917848 |
Internal Acc. | EST641995 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Polyphenol oxidase A1, chloroplastic OS=Vicia faba E-value=6e-25; Polyphenol oxidase, chloroplastic OS=Malus domestica E-value=7e-12; Polyphenol oxidase, chloroplastic OS=Vitis vinifera E-value=2e-08; Catechol oxidase B, chloroplastic (Fragment) OS=Solanum tuberosum E-value=8e-08; Polyphenol oxidase F, chloroplastic OS=Solanum lycopersicum E-value=2e-07; |
Length | 269 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GPOD; |
Sequence | TTCTAAACATAGAATATTACCAAGACGCCAAGTGATCACATTGAGTGGTAATAATGGTAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |