Detail of EST/Unigene CA917868 |
Acc. | CA917868 |
Internal Acc. | EST642015 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Acetate--CoA ligase ACS, chloroplastic/glyoxysomal OS=Arabidopsis thaliana E-value=0; Acetyl-coenzyme A synthetase, cytoplasmic OS=Mus musculus E-value=4e-96; Acetyl-coenzyme A synthetase, cytoplasmic OS=Homo sapiens E-value=6e-96; Acetyl-coenzyme A synthetase 2 OS=Rhizobium meliloti (strain 1021) E-value=5e-95; Acetyl-coenzyme A synthetase 2 OS=Pseudomonas aeruginosa (strain ATCC 15692 / PAO1 / 1C / PRS 101 / LMG 12228) E-value=5e-95; |
Length | 680 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GPOD; |
Sequence | GCATTTAAGTATGCTATTTGACTACAAGCCATCTGACATCTACTGGTGTACAGCTGATTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01895 acetyl-CoA synthetase |
EC | 6.2.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 833655 |
Trichome-related Gene from Literature | N/A |