Detail of EST/Unigene CA917973 |
Acc. | CA917973 |
Internal Acc. | EST642120 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S19, chloroplastic OS=Lotus japonicus E-value=4e-24; 30S ribosomal protein S19, chloroplastic OS=Glycine max E-value=6e-24; 30S ribosomal protein S19, chloroplastic OS=Phaseolus vulgaris E-value=6e-24; 30S ribosomal protein S19, chloroplastic OS=Phaseolus angularis E-value=6e-24; 30S ribosomal protein S19, chloroplastic OS=Morus indica E-value=8e-24; |
Length | 587 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GPOD; |
Sequence | TAAATTAGCTTAACACAAAAGGAGAAAAAGAAATAATAATAACTTGGTCCAGAACATCTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | N/A |
Trichome-related Gene from Literature | N/A |