Detail of EST/Unigene CA917991 |
Acc. | CA917991 |
Internal Acc. | EST642138 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 89A9 OS=Arabidopsis thaliana E-value=3e-47; Cytochrome P450 89A2 OS=Arabidopsis thaliana E-value=8e-45; Cytochrome P450 77A1 (Fragment) OS=Solanum melongena E-value=6e-27; Cytochrome P450 77A4 OS=Arabidopsis thaliana E-value=1e-25; Cytochrome P450 77A3 OS=Glycine max E-value=9e-25; |
Length | 753 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GPOD; |
Sequence | GCGCCACAAAAGAGTAAAGTTGCACCAAACATTTACGTAAATATGGAACCATGGTTCATT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00513 cytochrome P450, family 21, subfamily A (steroid 21-monooxygenase); Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07422 cytochrome P450, family 2, subfamily U |
EC | 1.14.99.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 815688 |
Trichome-related Gene from Literature | N/A |