Detail of EST/Unigene CA918162 |
Acc. | CA918162 |
Internal Acc. | EST642309 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin-like 1-1, chloroplastic OS=Arabidopsis thaliana E-value=1e-52; Thioredoxin-like 1-2, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-49; Thioredoxin-like 1-1, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-46; Thioredoxin-like 1-3, chloroplastic OS=Arabidopsis thaliana E-value=4e-44; Thioredoxin-like 1-2, chloroplastic OS=Arabidopsis thaliana E-value=7e-38; |
Length | 642 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_GPOD; |
Sequence | ACTCTCTTCAAAATTCAAAGGTTTTTGAACAAAAAATTGATTTTCAATGGCGGAAACTTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837379 |
Trichome-related Gene from Literature | N/A |