Detail of EST/Unigene CA918645 |
Acc. | CA918645 |
Internal Acc. | EST636363 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=6e-27; 28 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=2e-25; 28 kDa ribonucleoprotein, chloroplastic OS=Spinacia oleracea E-value=2e-25; 33 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=8e-25; 31 kDa ribonucleoprotein, chloroplastic OS=Arabidopsis thaliana E-value=1e-24; |
Length | 676 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | GCAATTCAATGTATGATTTTCATTGAGACAAGAATGAAAGAAGCAATATAACATAGCCAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842294 |
Trichome-related Gene from Literature | N/A |