Detail of EST/Unigene CA918770 |
Acc. | CA918770 |
Internal Acc. | EST636488 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 8, chloroplastic OS=Solanum lycopersicum E-value=2e-20; Chlorophyll a-b binding protein P4, chloroplastic OS=Pisum sativum E-value=3e-20; Chlorophyll a-b binding protein 3, chloroplastic OS=Pisum sativum E-value=1e-19; Chlorophyll a-b binding protein 4, chloroplastic OS=Arabidopsis thaliana E-value=2e-19; Chlorophyll a-b binding protein 7, chloroplastic OS=Solanum lycopersicum E-value=1e-17; |
Length | 625 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | CAAGTTTGTTATTTAGTTAATATATCAACTGTAAATGAAAACTTAAAAGGGGAAAACATT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841099 |
Trichome-related Gene from Literature | N/A |