Detail of EST/Unigene CA918775 |
Acc. | CA918775 |
Internal Acc. | EST636493 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-97; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=5e-97; Chlorophyll a-b binding protein 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=8e-97; Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=1e-96; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=1e-96; |
Length | 714 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | GATCCAAATGCACCAAATATTTTACTAAATTAATTAACAATAAGAAACAAGCACTCTGAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818005 |
Trichome-related Gene from Literature | N/A |