| Detail of EST/Unigene CA918825 |
| Acc. | CA918825 |
| Internal Acc. | EST636543 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin M3, chloroplastic OS=Arabidopsis thaliana E-value=2e-39; Thioredoxin M3, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-28; Thioredoxin M-type, chloroplastic OS=Chlamydomonas reinhardtii E-value=3e-26; Thioredoxin M2, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-26; Thioredoxin M-type, chloroplastic OS=Pisum sativum E-value=6e-26; |
| Length | 694 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTUS_MIXTISSUE; |
| Sequence | CAAGATCGCACCTATTGTGTGAAAAAAAATAAAAATACACCAAGTATATACATGAAGAAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 816050 |
| Trichome-related Gene from Literature | N/A |