Detail of EST/Unigene CA918830 |
Acc. | CA918830 |
Internal Acc. | EST636548 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable phospholipid hydroperoxide glutathione peroxidase OS=Citrus sinensis E-value=2e-50; Probable phospholipid hydroperoxide glutathione peroxidase OS=Nicotiana tabacum E-value=1e-49; Probable phospholipid hydroperoxide glutathione peroxidase OS=Nicotiana sylvestris E-value=1e-49; Probable phospholipid hydroperoxide glutathione peroxidase OS=Mesembryanthemum crystallinum E-value=2e-49; Probable phospholipid hydroperoxide glutathione peroxidase OS=Spinacia oleracea E-value=3e-49; |
Length | 569 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | AAACGAAGCTTATGTAATCATTTACATTCATACAGAAGTAACAAGTCAAGTACACAATCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00432 glutathione peroxidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K05361 phospholipid-hydroperoxide glutathione peroxidase |
EC | 1.11.1.7 1.11.1.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826765 |
Trichome-related Gene from Literature | N/A |