Detail of EST/Unigene CA918991 |
Acc. | CA918991 |
Internal Acc. | EST636709 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glycine cleavage system H protein, mitochondrial OS=Pisum sativum E-value=9e-63; Glycine cleavage system H protein, mitochondrial OS=Flaveria anomala E-value=1e-59; Glycine cleavage system H protein, mitochondrial OS=Flaveria pringlei E-value=2e-59; Glycine cleavage system H protein, mitochondrial (Fragment) OS=Flaveria pubescens E-value=3e-59; Probable glycine cleavage system H protein 2, mitochondrial OS=Arabidopsis thaliana E-value=2e-57; |
Length | 522 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | ATTATTATTTGTACTCTTATCACAAACACAACACAAAGAAGCAGAAGTAGTCTTAACAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 840141 |
Trichome-related Gene from Literature | N/A |