Detail of EST/Unigene CA919077 |
Acc. | CA919077 |
Internal Acc. | EST636795 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Heparanase-like protein 3 OS=Arabidopsis thaliana E-value=7e-43; Heparanase-like protein 1 OS=Arabidopsis thaliana E-value=4e-29; Heparanase-like protein 2 OS=Arabidopsis thaliana E-value=6e-28; Baicalin-beta-D-glucuronidase OS=Scutellaria baicalensis E-value=1e-27; Heparanase OS=Homo sapiens E-value=5e-08; |
Length | 698 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | GTCACTTTCAATTTGCTTTTCTCATCATAATGCATTCAATTAATAACCACAGGGAAGCAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Glycan Biosynthesis and Metabolism > ko01032 Glycan structures - Degradation > K07964 heparanase 1; Metabolism > Glycan Biosynthesis and Metabolism > ko00531 Glycosaminoglycan degradation > K07964 heparanase 1; Metabolism > Glycan Biosynthesis and Metabolism > ko01032 Glycan structures - Degradation > K07965 heparanase 2; Metabolism > Glycan Biosynthesis and Metabolism > ko00531 Glycosaminoglycan degradation > K07965 heparanase 2 |
EC | 3.2.1.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 833437 |
Trichome-related Gene from Literature | N/A |