Detail of EST/Unigene CA919631 |
Acc. | CA919631 |
Internal Acc. | EST637349 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Quinone oxidoreductase-like protein At1g23740, chloroplastic OS=Arabidopsis thaliana E-value=7e-68; Reticulon-4-interacting protein 1 homolog, mitochondrial OS=Danio rerio E-value=1e-15; Reticulon-4-interacting protein 1, mitochondrial OS=Mus musculus E-value=2e-15; Reticulon-4-interacting protein 1, mitochondrial OS=Bos taurus E-value=3e-15; Reticulon-4-interacting protein 1, mitochondrial OS=Homo sapiens E-value=8e-14; |
Length | 666 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | CTCGATAAGAGAAAATGTTGAAAAACAGTGTTAAAGTGATTGTTGCTATCACTTTTCTCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838984 |
Trichome-related Gene from Literature | N/A |