| Detail of EST/Unigene CA919670 |
| Acc. | CA919670 |
| Internal Acc. | EST637388 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Arogenate dehydratase/prephenate dehydratase 6, chloroplastic OS=Arabidopsis thaliana E-value=2e-97; Arogenate dehydratase 3, chloroplastic OS=Arabidopsis thaliana E-value=7e-95; Arogenate dehydratase 5, chloroplastic OS=Arabidopsis thaliana E-value=8e-82; Arogenate dehydratase 4, chloroplastic OS=Arabidopsis thaliana E-value=1e-81; Arogenate dehydratase/prephenate dehydratase 1, chloroplastic OS=Arabidopsis thaliana E-value=1e-60; |
| Length | 753 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTUS_MIXTISSUE; |
| Sequence | CCTTCACAAATTTGAACTTTTATAACAATTAACATGATAAGAGTAAGACACACTATATAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837345 |
| Trichome-related Gene from Literature | N/A |