Detail of EST/Unigene CA919810 |
Acc. | CA919810 |
Internal Acc. | EST637528 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Protease Do-like 9 OS=Arabidopsis thaliana E-value=2e-53; Protease Do-like 10, mitochondrial OS=Arabidopsis thaliana E-value=1e-24; Protease Do-like 2, chloroplastic OS=Arabidopsis thaliana E-value=6e-18; Protease Do-like 4, mitochondrial OS=Arabidopsis thaliana E-value=9e-18; Putative protease Do-like 3, mitochondrial OS=Arabidopsis thaliana E-value=5e-16; |
Length | 746 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | ACGTTGCTCAGTGCCCTCATAATTAAAAATAATACAGTAATTATACCGGAAGACAAGCGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 834018 |
Trichome-related Gene from Literature | N/A |