| Detail of EST/Unigene CA919892 |
| Acc. | CA919892 |
| Internal Acc. | EST637610 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Thioredoxin F-type, chloroplastic OS=Pisum sativum E-value=7e-49; Thioredoxin F2, chloroplastic OS=Arabidopsis thaliana E-value=3e-46; Thioredoxin F1, chloroplastic OS=Arabidopsis thaliana E-value=1e-45; Thioredoxin F-type, chloroplastic OS=Brassica napus E-value=6e-45; Thioredoxin F-type, chloroplastic OS=Mesembryanthemum crystallinum E-value=9e-44; |
| Length | 651 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTUS_MIXTISSUE; |
| Sequence | AAAATAAAAGCAATCTGAGCCACCTTTATAGATAGCCCATGATCAAGTTGATAACAGAAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 831501 |
| Trichome-related Gene from Literature | N/A |