Detail of EST/Unigene CA920053 |
Acc. | CA920053 |
Internal Acc. | EST637771 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Replication factor A protein 2 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=5e-07; |
Length | 767 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | TGTTAAATTCAGACGTGAGATCATTTAAAGTGTTCGGTAATTTAGTCAAAAAACATAATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10739 replication factor A2; Genetic Information Processing > Replication and Repair > ko03440 Homologous recombination > K10739 replication factor A2; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10739 replication factor A2; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10739 replication factor A2 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 816985 |
Trichome-related Gene from Literature | N/A |