| Detail of EST/Unigene CA920483 |
| Acc. | CA920483 |
| Internal Acc. | EST638201 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Geraniol synthase, chloroplastic OS=Ocimum basilicum E-value=5e-52; R-linalool synthase, chloroplastic OS=Ocimum basilicum E-value=2e-46; (E)-beta-ocimene synthase, chloroplastic OS=Arabidopsis thaliana E-value=2e-35; (-)-alpha-terpineol synthase OS=Vitis vinifera E-value=7e-35; (-)-camphene/tricyclene synthase, chloroplastic OS=Solanum lycopersicum E-value=2e-34; |
| Length | 743 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTUS_MIXTISSUE; |
| Sequence | GACAAAATATGTCATTTATAATTTTATTTTTTTCAATCTACAAGTTATTTTTTATAAGCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827376 |
| Trichome-related Gene from Literature | N/A |