Detail of EST/Unigene CA920483 |
Acc. | CA920483 |
Internal Acc. | EST638201 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Geraniol synthase, chloroplastic OS=Ocimum basilicum E-value=5e-52; R-linalool synthase, chloroplastic OS=Ocimum basilicum E-value=2e-46; (E)-beta-ocimene synthase, chloroplastic OS=Arabidopsis thaliana E-value=2e-35; (-)-alpha-terpineol synthase OS=Vitis vinifera E-value=7e-35; (-)-camphene/tricyclene synthase, chloroplastic OS=Solanum lycopersicum E-value=2e-34; |
Length | 743 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | GACAAAATATGTCATTTATAATTTTATTTTTTTCAATCTACAAGTTATTTTTTATAAGCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827376 |
Trichome-related Gene from Literature | N/A |