Detail of EST/Unigene CA920676 |
Acc. | CA920676 |
Internal Acc. | EST638394 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Translation factor GUF1 homolog, chloroplastic OS=Populus trichocarpa E-value=2e-65; Translation factor GUF1 homolog, chloroplastic OS=Vitis vinifera E-value=5e-65; Translation factor GUF1 homolog, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-62; Translation factor GUF1 homolog, chloroplastic OS=Oryza sativa subsp. indica E-value=2e-62; Translation factor GUF1 homolog, chloroplastic OS=Arabidopsis thaliana E-value=3e-62; |
Length | 698 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | GATTACATGTTGGATCATATTACAATAAAAGAATACATCAAATTTTCCCGATATATTTAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830766 |
Trichome-related Gene from Literature | N/A |