Detail of EST/Unigene CA920713 |
Acc. | CA920713 |
Internal Acc. | EST638431 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 26.5 kDa heat shock protein, mitochondrial OS=Arabidopsis thaliana E-value=7e-42; 23.6 kDa heat shock protein, mitochondrial OS=Oryza sativa subsp. japonica E-value=1e-17; 25.3 kDa heat shock protein, chloroplastic OS=Arabidopsis thaliana E-value=6e-13; Small heat shock protein, chloroplastic (Fragment) OS=Glycine max E-value=1e-12; Small heat shock protein, chloroplastic OS=Pisum sativum E-value=2e-12; |
Length | 657 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | GATACAATTTATTCATATATTTTATAGGTAAGAAACTTTATTTGATTCTCTATGAAATTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841687 |
Trichome-related Gene from Literature | N/A |