Detail of EST/Unigene CA920823 |
Acc. | CA920823 |
Internal Acc. | EST638541 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Protein midA, mitochondrial OS=Dictyostelium discoideum E-value=4e-23; Protein midA homolog, mitochondrial OS=Drosophila melanogaster E-value=9e-18; Protein midA homolog, mitochondrial OS=Mus musculus E-value=2e-17; Protein midA homolog, mitochondrial OS=Xenopus laevis E-value=6e-17; Protein midA homolog, mitochondrial OS=Rattus norvegicus E-value=6e-17; |
Length | 781 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | CTACAATGCAATATTTAAATTATTAACGTTATCTTTTGCAATGCAACTCTTACAATGCAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822500 |
Trichome-related Gene from Literature | N/A |