Detail of EST/Unigene CA920909 |
Acc. | CA920909 |
Internal Acc. | EST638627 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Acetate--CoA ligase ACS, chloroplastic/glyoxysomal OS=Arabidopsis thaliana E-value=2e-84; Acetyl-coenzyme A synthetase OS=Rhodobacter capsulatus (strain ATCC BAA-309 / NBRC 16581 / SB1003) E-value=3e-62; Acetyl-coenzyme A synthetase OS=Xanthomonas campestris pv. campestris (strain ATCC 33913 / NCPPB 528 / LMG 568) E-value=4e-62; Acetyl-coenzyme A synthetase OS=Xanthomonas campestris pv. campestris (strain 8004) E-value=4e-62; Acetyl-coenzyme A synthetase OS=Bdellovibrio bacteriovorus (strain ATCC 15356 / DSM 50701 / NCIB 9529 / HD100) E-value=6e-62; |
Length | 775 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | TTATTTTCCCTCACTTTCCAACCCAGCTCAAACTAAATTATTTATTTATCATATAAATGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01895 acetyl-CoA synthetase |
EC | 6.2.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 833655 |
Trichome-related Gene from Literature | N/A |