| Detail of EST/Unigene CA921034 |
| Acc. | CA921034 |
| Internal Acc. | EST638752 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Zeaxanthin epoxidase, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-08; Zeaxanthin epoxidase, chloroplastic OS=Prunus armeniaca E-value=1e-07; Zeaxanthin epoxidase, chloroplastic OS=Arabidopsis thaliana E-value=2e-07; Zeaxanthin epoxidase, chloroplastic OS=Nicotiana plumbaginifolia E-value=2e-07; 6-hydroxynicotinate 3-monooxygenase OS=Pseudomonas putida (strain KT2440) E-value=2e-06; |
| Length | 784 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTUS_MIXTISSUE; |
| Sequence | CGAGGGATCAATTATCATCTTTCATTCATTATGATTTTTATTTTTACAAGACCATTCATT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830011 |
| Trichome-related Gene from Literature | N/A |