Detail of EST/Unigene CA921354 |
Acc. | CA921354 |
Internal Acc. | EST639072 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase OS=Solanum tuberosum E-value=1e-39; Cysteine synthase OS=Citrullus lanatus E-value=3e-39; Cysteine synthase OS=Zea mays E-value=6e-39; Cysteine synthase OS=Brassica juncea E-value=4e-38; Cysteine synthase OS=Spinacia oleracea E-value=6e-38; |
Length | 525 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | AATTTAAAGCAATTTTATTTAAAGTTTATGTCTGCATGGACACTTATTGAACTGTCTTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K01697 cystathionine beta-synthase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K01697 cystathionine beta-synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01697 cystathionine beta-synthase; Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K01738 cysteine synthase; Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K01738 cysteine synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01738 cysteine synthase |
EC | 2.5.1.47 4.2.1.22 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819654 |
Trichome-related Gene from Literature | N/A |