Detail of EST/Unigene CA921587 |
Acc. | CA921587 |
Internal Acc. | EST639305 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable acyl-activating enzyme 1, peroxisomal OS=Arabidopsis thaliana E-value=5e-32; Probable acyl-activating enzyme 21 OS=Arabidopsis thaliana E-value=1e-26; Acetate/butyrate--CoA ligase AAE7, peroxisomal OS=Arabidopsis thaliana E-value=3e-26; Probable acyl-activating enzyme 2 OS=Arabidopsis thaliana E-value=4e-26; Probable acyl-activating enzyme 6 OS=Arabidopsis thaliana E-value=6e-23; |
Length | 826 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | GTAACATTCAACACAACTCATAATAATACATAGATTGTATGTCTTTAGAAAACACTGACA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00010 Glycolysis / Gluconeogenesis > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K01895 acetyl-CoA synthetase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01895 acetyl-CoA synthetase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K01897 long-chain acyl-CoA synthetase |
EC | 6.2.1.3 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838644 |
Trichome-related Gene from Literature | N/A |