Detail of EST/Unigene CA921664 |
Acc. | CA921664 |
Internal Acc. | EST639382 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Light-induced protein, chloroplastic OS=Solanum tuberosum E-value=3e-81; Light-induced protein, chloroplastic OS=Solanum demissum E-value=8e-81; Plastid-lipid-associated protein, chloroplastic OS=Citrus unshiu E-value=3e-79; Probable plastid-lipid-associated protein 1, chloroplastic OS=Arabidopsis thaliana E-value=4e-78; Plastid lipid-associated protein 2, chloroplastic OS=Brassica campestris E-value=2e-77; |
Length | 825 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | TTATTTTGTATAGAAATGTTCAAATGTAAGAATATACAGCGGATGATACTACATATACAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825714 |
Trichome-related Gene from Literature | N/A |