Detail of EST/Unigene CA921711 |
Acc. | CA921711 |
Internal Acc. | EST639429 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 14 OS=Arabidopsis thaliana E-value=1e-19; Glucan endo-1,3-beta-glucosidase 10 OS=Arabidopsis thaliana E-value=4e-13; Glucan endo-1,3-beta-glucosidase 11 OS=Arabidopsis thaliana E-value=4e-12; Probable glucan endo-1,3-beta-glucosidase A6 OS=Arabidopsis thaliana E-value=8e-11; Glucan endo-1,3-beta-glucosidase 13 OS=Arabidopsis thaliana E-value=5e-10; |
Length | 591 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | CAGACTATTGTATTTTCATTTTGTACCAGTAAAGTACTATTACAAAGTCAAACTATAACA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817295 |
Trichome-related Gene from Literature | N/A |