Detail of EST/Unigene CA921716 |
Acc. | CA921716 |
Internal Acc. | EST639434 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Alternative oxidase 2, mitochondrial OS=Glycine max E-value=3e-87; Alternative oxidase, mitochondrial OS=Mangifera indica 1 E-value=2e-83; Alternative oxidase 2, mitochondrial OS=Arabidopsis thaliana E-value=8e-80; Alternative oxidase 3, mitochondrial OS=Glycine max E-value=2e-78; Alternative oxidase 1a, mitochondrial OS=Arabidopsis thaliana E-value=9e-76; |
Length | 746 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | ATTAGGTGGGTTCTATAGAGTCATTAGTATACATAGTCTAATCAGCATGCTCTTTACAAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836542 |
Trichome-related Gene from Literature | 836542 |