Detail of EST/Unigene CA921732 |
Acc. | CA921732 |
Internal Acc. | EST639450 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-fructofuranosidase, insoluble isoenzyme CWINV1 OS=Arabidopsis thaliana E-value=2e-43; Beta-fructofuranosidase, insoluble isoenzyme CWINV3 OS=Arabidopsis thaliana E-value=5e-43; Beta-fructofuranosidase, insoluble isoenzyme 5 OS=Oryza sativa subsp. japonica E-value=1e-37; Fructan 1-exohydrolase OS=Bromus pictus E-value=3e-36; Beta-fructofuranosidase, insoluble isoenzyme CWINV5 OS=Arabidopsis thaliana E-value=4e-36; |
Length | 767 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | GACTTATCAATCCAAAATTAACACAATAAATTTATCTGTTGAACAAAAAAAAAATAAAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820591 |
Trichome-related Gene from Literature | N/A |