Detail of EST/Unigene CA921798 |
Acc. | CA921798 |
Internal Acc. | EST639516 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Exostosin-2 OS=Drosophila melanogaster E-value=8e-17; Exostosin-1c OS=Danio rerio E-value=4e-15; Exostosin-3 OS=Drosophila melanogaster E-value=6e-14; Exostosin-2 OS=Mus musculus E-value=6e-14; Exostosin-2 OS=Homo sapiens E-value=6e-14; |
Length | 699 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | TACTATTTAGAAAACCCCCTAAAATAAAATCACAAATGGGATACAAGTATAAACAAGACT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K02367 glucuronyl/N-acetylglucosaminyl transferase EXT2; Metabolism > Glycan Biosynthesis and Metabolism > ko00534 Heparan sulfate biosynthesis > K02367 glucuronyl/N-acetylglucosaminyl transferase EXT2; Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K02369 alpha-1,4-N-acetylglucosaminyltransferase EXTL2; Metabolism > Glycan Biosynthesis and Metabolism > ko00534 Heparan sulfate biosynthesis > K02369 alpha-1,4-N-acetylglucosaminyltransferase EXTL2 |
EC | 2.4.1.223 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 830329 |
Trichome-related Gene from Literature | N/A |