Detail of EST/Unigene CA921913 |
Acc. | CA921913 |
Internal Acc. | EST639631 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable ethanolamine kinase OS=Nematostella vectensis E-value=1e-10; Choline/ethanolamine kinase OS=Mus musculus E-value=7e-09; Ethanolamine kinase 2 OS=Rattus norvegicus E-value=9e-09; Ethanolamine kinase 2 OS=Mus musculus E-value=1e-08; Choline/ethanolamine kinase OS=Homo sapiens E-value=1e-08; |
Length | 571 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | AAATTCAACACCTAATTTATCATTCATAAGACTTGAATCCAAGACTTCCTCACAAAGAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00564 Glycerophospholipid metabolism > K00866 choline kinase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00866 choline kinase; Metabolism > Lipid Metabolism > ko00564 Glycerophospholipid metabolism > K00894 ethanolamine kinase |
EC | 2.7.1.32 2.7.1.82 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843772 |
Trichome-related Gene from Literature | N/A |