| Detail of EST/Unigene CA922136 |
| Acc. | CA922136 |
| Internal Acc. | EST639854 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 2-methoxy-6-polyprenyl-1,4-benzoquinol methylase, mitochondrial OS=Arabidopsis thaliana E-value=2e-14; 2-methoxy-6-polyprenyl-1,4-benzoquinol methylase, mitochondrial OS=Oryza sativa subsp. japonica E-value=1e-12; 2-methoxy-6-polyprenyl-1,4-benzoquinol methylase, mitochondrial OS=Bos taurus E-value=4e-10; 2-methoxy-6-polyprenyl-1,4-benzoquinol methylase, mitochondrial OS=Gallus gallus E-value=9e-10; 2-methoxy-6-polyprenyl-1,4-benzoquinol methylase, mitochondrial OS=Xenopus laevis E-value=1e-09; |
| Length | 211 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTUS_MIXTISSUE; |
| Sequence | ATAATACATGAACTTGCTTATAAATAGTTAAGAAAGATGCATGATTTATTATATAATTAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Metabolism of Cofactors and Vitamins > ko00130 Ubiquinone biosynthesis > K06127 ubiquinone biosynthesis methyltransferase |
| EC | 2.1.1.- |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835835 |
| Trichome-related Gene from Literature | N/A |