Detail of EST/Unigene CA922136 |
Acc. | CA922136 |
Internal Acc. | EST639854 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 2-methoxy-6-polyprenyl-1,4-benzoquinol methylase, mitochondrial OS=Arabidopsis thaliana E-value=2e-14; 2-methoxy-6-polyprenyl-1,4-benzoquinol methylase, mitochondrial OS=Oryza sativa subsp. japonica E-value=1e-12; 2-methoxy-6-polyprenyl-1,4-benzoquinol methylase, mitochondrial OS=Bos taurus E-value=4e-10; 2-methoxy-6-polyprenyl-1,4-benzoquinol methylase, mitochondrial OS=Gallus gallus E-value=9e-10; 2-methoxy-6-polyprenyl-1,4-benzoquinol methylase, mitochondrial OS=Xenopus laevis E-value=1e-09; |
Length | 211 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | ATAATACATGAACTTGCTTATAAATAGTTAAGAAAGATGCATGATTTATTATATAATTAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Metabolism of Cofactors and Vitamins > ko00130 Ubiquinone biosynthesis > K06127 ubiquinone biosynthesis methyltransferase |
EC | 2.1.1.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835835 |
Trichome-related Gene from Literature | N/A |