Detail of EST/Unigene CA922295 |
Acc. | CA922295 |
Internal Acc. | EST640013 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | ABC transporter B family member 20 OS=Arabidopsis thaliana E-value=1e-49; ABC transporter B family member 6 OS=Arabidopsis thaliana E-value=5e-46; ABC transporter B family member 19 OS=Arabidopsis thaliana E-value=2e-20; Lipid A export ATP-binding/permease protein MsbA OS=Thiobacillus denitrificans (strain ATCC 25259) E-value=3e-20; Lipid A export ATP-binding/permease protein MsbA OS=Neisseria gonorrhoeae (strain ATCC 700825 / FA 1090) E-value=3e-20; |
Length | 822 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | TTGGAATGAGAGGTGTTGACTTAACTCCAGGACAGAAACAGAGGATTGCAATTGCAAGGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Membrane Transport > ko02010 ABC transporters > K05655 ATP-binding cassette, subfamily B (MDR/TAP), member 8; Environmental Information Processing > Membrane Transport > ko02010 ABC transporters > K05657 ATP-binding cassette, subfamily B (MDR/TAP), member 10; Environmental Information Processing > Membrane Transport > ko02010 ABC transporters > K05658 ATP-binding cassette, subfamily B (MDR/TAP), member 1 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 3.A.1 ATP-binding-cassette superfamily ABC ABC-type importers (all from Bacteria and Archaea) |
Probeset |
|
Corresponding NCBI Gene | 824698 |
Trichome-related Gene from Literature | N/A |