| Detail of EST/Unigene CA922362 |
| Acc. | CA922362 |
| Internal Acc. | EST640080 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Isoflavone 2'-hydroxylase OS=Glycyrrhiza echinata E-value=2e-61; Cytochrome P450 81D1 OS=Arabidopsis thaliana E-value=5e-38; Cytochrome P450 81F1 OS=Arabidopsis thaliana E-value=2e-32; Cytochrome P450 82G1 OS=Arabidopsis thaliana E-value=4e-23; Beta-amyrin 24-hydroxylase OS=Glycine max E-value=3e-21; |
| Length | 694 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTUS_MIXTISSUE; |
| Sequence | AGTACTACAGTCTACAGTAACTGTTTATTTTGTACCCACTCACTCTGATAGTACTAATTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829889 |
| Trichome-related Gene from Literature | N/A |