Detail of EST/Unigene CA922439 |
Acc. | CA922439 |
Internal Acc. | EST640157 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Alternative oxidase 4, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=4e-80; Alternative oxidase 2, mitochondrial OS=Nicotiana tabacum E-value=1e-06; Alternative oxidase 1, mitochondrial OS=Nicotiana tabacum E-value=5e-06; Alternative oxidase 1a, mitochondrial OS=Arabidopsis thaliana E-value=1e-05; |
Length | 825 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | CATGAAAAAAATGCTCTTTAAATTATATTTATCTTTTGAAGTATATAAAATACAAATATA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828321 |
Trichome-related Gene from Literature | N/A |