| Detail of EST/Unigene CA922439 |
| Acc. | CA922439 |
| Internal Acc. | EST640157 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Alternative oxidase 4, chloroplastic/chromoplastic OS=Arabidopsis thaliana E-value=4e-80; Alternative oxidase 2, mitochondrial OS=Nicotiana tabacum E-value=1e-06; Alternative oxidase 1, mitochondrial OS=Nicotiana tabacum E-value=5e-06; Alternative oxidase 1a, mitochondrial OS=Arabidopsis thaliana E-value=1e-05; |
| Length | 825 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MTUS_MIXTISSUE; |
| Sequence | CATGAAAAAAATGCTCTTTAAATTATATTTATCTTTTGAAGTATATAAAATACAAATATA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828321 |
| Trichome-related Gene from Literature | N/A |