Detail of EST/Unigene CA922500 |
Acc. | CA922500 |
Internal Acc. | EST640218 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Serine hydroxymethyltransferase, cytosolic OS=Oryctolagus cuniculus E-value=1e-53; Serine hydroxymethyltransferase, mitochondrial OS=Homo sapiens E-value=2e-53; Serine hydroxymethyltransferase, cytosolic OS=Bos taurus E-value=4e-53; Serine hydroxymethyltransferase, mitochondrial OS=Bos taurus E-value=5e-53; Serine hydroxymethyltransferase, cytosolic OS=Pongo abelii E-value=5e-53; |
Length | 794 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | AAAGTATTCAGGGATGTAATTAGAGCATCATCAACAGAAGACACATTTTGTCAGGAAATG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00680 Methane metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00600 glycine hydroxymethyltransferase; Metabolism > Metabolism of Cofactors and Vitamins > ko00670 One carbon pool by folate > K00600 glycine hydroxymethyltransferase |
EC | 2.1.2.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829387 |
Trichome-related Gene from Literature | N/A |