Detail of EST/Unigene CA922739 |
Acc. | CA922739 |
Internal Acc. | EST640457 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | RING finger protein 141 OS=Gallus gallus E-value=2e-07; RING finger protein 141 OS=Rattus norvegicus E-value=2e-07; RING finger protein 141 OS=Pongo abelii E-value=2e-07; RING finger protein 141 OS=Mus musculus E-value=2e-07; RING finger protein 141 OS=Homo sapiens E-value=2e-07; |
Length | 703 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MTUS_MIXTISSUE; |
Sequence | AGTTGACATTCAATATTCCATCCAATGCATTCATGATCAAAGATTTTTAGGAGGGAGGGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K04707 E3 ubiquitin-protein ligase CBL; Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04707 E3 ubiquitin-protein ligase CBL; Environmental Information Processing > Signal Transduction > ko04630 Jak-STAT signaling pathway > K04707 E3 ubiquitin-protein ligase CBL |
EC | 6.3.2.19 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835995 |
Trichome-related Gene from Literature | N/A |